For research use only. We do not sell to patients.
Bepirovirsen
CAS No. : 1403787-62-1
Biological Activity：Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
Research Area：Infection
Targets：HBV
Related Small Molecules:DVR-01;Bicyclol;Catalpol;Schisantherin C;HBV-IN-20;Glycosmisic acid;Schisanwilsonin C;RO6889678;Thiamine hydrochloride;Evixapodlin;Canocapavir;HBV-IN-19;Bifendate-d6;(5S,8R)-HBV-IN-10;Punicalin;OSS_128167;3′-DMTr-dG(iBu);HBV-IN-8;HBV-IN-7;L-2′-Fd4C;AB-729;Hepatitis B Virus Core (128-140);Besifovir Dipivoxil maleate;AT-130;HBV-IN-4
Trending products：Recombinant Proteins | Bioactive Screening Libraries | Natural Products | Fluorescent Dye | PROTAC | Isotope-Labeled Compounds | Oligonucleotides
About Us:
- MedChemExpress (MCE) offers a wide range of high-quality research chemicals and biochemicals (novel life-science reagents, reference compounds and natural compounds) for scientific use；
- Structurally and synthetically diverse biologically active compounds；
- roduct quality is the key to our success and we take pride in offering only the highest-grade products.；
- We provide HNMR, LC-MS, HPLC, stability testing and activity assays of our products to clients.；
- Product identity, quality, purity and activity are assured by our robust quality control programs and procedures.；
- Customized order volume ranging from milligrams to kilograms scale；
Structurally and synthetically diverse biologically active compounds；
We provide customer-oriented services. To explore more, please contact us at [email protected]. Our team will gladly assist you.
